MirGeneDB

MirGeneDB ID

Xtr-Mir-9-P4

Family name MIR-9 (all species)
Seed AAAGCUA
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-9b
Paralogues Xtr-Mir-9-P1  Xtr-Mir-9-P2  Xtr-Mir-9-P3 
Orthologues Aca-Mir-9-P4  Ami-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(xenTro7)
KB021649: 128228901-128228960 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GGAAGUAUCCUGGCUUUGAAUUGGUUUCUGUCUUUGGUUACCUAGCUGUAUGAGUAUAACUAAUGUCAUAAAGCUAGACAACCGAACGUAUAAACCAGUUCCUCCAUCUUCACAGCAGAG
Get precursor sequence
Structure
        10          20        30        40        50         
GGAAGUAUCCUGGCUUU--|         C  UC       AC      G    AGUAUA 
                   GAAUUGGUUU UG  UUUGGUU  CUAGCU UAUG      A
                   CUUGACCAAA AU  AAGCCAA  GAUCGA AUAC      C
GAGACGACACUUCUACCUC^         U  GC       CA      A    UGUAAU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-9-P4_5p*

MirBase accessionMIMAT0003555
Sequence
0- UCUUUGGUUACCUAGCUGUAUG -22
Get sequence
Validated targets TargetScanVert: xtr-miR-9b-5p
Mature sequence

Xtr-Mir-9-P4_3p

MirBase accessionMIMAT0003556
Sequence
38- UAAAGCUAGACAACCGAACGUA -60
Get sequence
Validated targets TargetScanVert: xtr-miR-9b-3p