MirGeneDB

MirGeneDB ID

Gga-Mir-9-P4

Family name MIR-9 (all species)
Seed CUUUGGU
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-9-1
Paralogues Gga-Mir-9-P1  Gga-Mir-9-P2  Gga-Mir-9-P3 
Orthologues Aca-Mir-9-P4  Ami-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4  Xtr-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
28: 3623186-3623246 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGAUCUUAAAGACCUUGGGUUGGUUUUUCUCUUUGGUUAUCUAGCUGUAUGAGUGUAUGUGAUAUCAUAAAGCUAGAGAACCGAAUGUAAAAACCCGCUCGCUAUUCUCCAGGUAAAUCC
Get precursor sequence
Structure
        10           20        30        40        50         
CGGAUCUUAAAGACCUU---|   U       CUC       A       G    AGUGUA 
                    GGGU GGUUUUU   UUUGGUU UCUAGCU UAUG      U
                    CUCG CCAAAAA   AAGCCAA AGAUCGA AUAC      G
CCUAAAUGGACCUCUUAUCG^   C       UGU       G       A    UAUAGU 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-9-P4_5p

MirBase accessionMIMAT0001195
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Star sequence

Gga-Mir-9-P4_3p*

MirBase accessionMIMAT0003350
Sequence
38- UAAAGCUAGAGAACCGAAUGUAA -61
Get sequence
Validated targets TargetScanVert: gga-miR-9-3p
miRDB: MIMAT0003350