MirGeneDB

MirGeneDB ID

Aca-Mir-9-P4

Family name MIR-9 (all species)
Seed CUUUGGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-9-3
Paralogues Aca-Mir-9-P2  Aca-Mir-9-P3 
Orthologues Ami-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4  Xtr-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
G889P613971RN1: 310-369 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAUGCGUAGACUUCCAGGGCCGGCUCUUCUCUUUGGUUAUCUAGCUGUAUGAGUGCGCCUGGUUUCAUAAAGCUAGAGAACCGAACGUACGAACCGGCCCGAUGCGCAACGUAUAUUCU
Get precursor sequence
Structure
        10          20        30        40        50         
GGAUGCGUAGACUUCCA--|      C  UUCUC       A       G    AGUGCG 
                   GGGCCGG UC     UUUGGUU UCUAGCU UAUG      C
                   CCCGGCC AG     AAGCCAA AGAUCGA AUAC      C
UCUUAUAUGCAACGCGUAG^      A  CAUGC       G       A    UUUGGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-9-P4_5p

MirBase accessionMIMAT0021990
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Star sequence

Aca-Mir-9-P4_3p*

MirBase accessionMIMAT0021992
Sequence
38- UAAAGCUAGAGAACCGAACGUA -60
Get sequence