MirGeneDB

MirGeneDB ID

Ami-Mir-9-P4

Family name MIR-9 (all species)
Seed CUUUGGU
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-9-4
Paralogues Ami-Mir-9-P1  Ami-Mir-9-P2  Ami-Mir-9-P3 
Orthologues Aca-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4  Xtr-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(allMis1)
JH735857: 281517-281576 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CCUGUUUCCAAAGACCUGGGUGGGUUUUUGUCUUUGGUUAUCUAGCUGUAUGAGUGUAUGUGAUAUCAUAAAGCUAGACAACCGAAUGUAAAAACCGGCUCGCUCCUCUCCGCGACUCCC
Get precursor sequence
Structure
        10          20        30        40        50         
CCUGUUUCCAAAGACCU--|   G        UC       A       G    AGUGUA 
                   GGGU GGUUUUUG  UUUGGUU UCUAGCU UAUG      U
                   CUCG CCAAAAAU  AAGCCAA AGAUCGA AUAC      G
CCCUCAGCGCCUCUCCUCG^   G        GU       C       A    UAUAGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ami-Mir-9-P4_5p

MirBase accessionMIMAT0038027
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Star sequence

Ami-Mir-9-P4_3p*

MirBase accessionMIMAT0038029
Sequence
38- UAAAGCUAGACAACCGAAUGUA -60
Get sequence