MirGeneDB

MirGeneDB ID

Oan-Mir-9-P4

Family name MIR-9 (all species)
Seed CUUUGGU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-9-1
Paralogues Oan-Mir-9-P1-v1  Oan-Mir-9-P1-v2  Oan-Mir-9-P2  Oan-Mir-9-P3 
Orthologues Aca-Mir-9-P4  Ami-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4  Xtr-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041749.1: 114595993-114596051 [-]
Precursor
(pre-Mir +30nt flank)
CGGGGCCGGAUCGCACUGAGCUGGCUUUGGUCUUUGGUUAUCUAGCUGUAUGAGUGUAUGUGAUGUCAUAAAGCUAGAGAACCGAAUGUAAAAACCAGCUUCCGCCGUCACAGCCCCGG
Get precursor sequence
Structure
        10         20        30        40        50         
CGGGGCCGGAUCGCACU-|      C   GGUC       A       G    AGUGUA 
                  GAGCUGG UUU    UUUGGUU UCUAGCU UAUG      U
                  UUCGACC AAA    AAGCCAA AGAUCGA AUAC      G
GGCCCCGACACUGCCGCC^      A   AUGU       G       A    UGUAGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Mir-9-P4_5p

MirBase accessionMIMAT0006792
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Star sequence

Oan-Mir-9-P4_3p*

MirBase accessionMIMAT0006793
Sequence
38- UAAAGCUAGAGAACCGAAUGU -59
Get sequence