MirGeneDB

MirGeneDB ID

Sto-Mir-9-P4

Family name MIR-9 (all species)
Seed CUUUGGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-9-P2  Sto-Mir-9-P3 
Orthologues Aca-Mir-9-P4  Ami-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Xtr-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01002607.1: 288230-288290 [+]
Precursor
(pre-Mir +30nt flank)
GGAUGAAGAGUUUGGCGAGGCUGGAUUUUCUCUUUGGUUAUCUAGCUGUAUGAGAUUGUUGAACCAUCAUAAAGCUAGAGAACCGAAUGUAUCUUUGGUUAUCUAGCUGUAUGAGAUUGUUGAACCAUCAUAAAGCUAGAGAACCGAAUGUAAAAACGGCUUCGAGGUUCACCGGGAAGCCC
Get precursor sequence
Structure
        10           20        30        40        50         
GGAUGAAGAGUUUGGCG---|     GAUUUUCUCUUUGGUUAUCUAGCUGUAUGAGAUUG 
                    AGGCUG                                   U
                    UUCGGC                                   U
CCCGAAGGGCCACUUGGAGC^     AAAAAUGUAAGCCAAGAGAUCGAAAUACUACCAAG 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-9-P4_5p*

MirBase accessionNone
Sequence
39- UAAAGCUAGAGAACCGAAUGUA -61
Get sequence
Mature sequence

Sto-Mir-9-P4_3p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence