MirGeneDB

MirGeneDB ID

Sto-Mir-9-P2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-9-P3  Sto-Mir-9-P4 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01001536.1: 489899-489959 [-]
Precursor
(pre-Mir +30nt flank)
AAACGCAAGGAUUGAGGAAGUUAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUUGCCCGUCAUAAAGCUAGAUAACCGAAAGUAAAAACUGCUUCUAGGGUCUUCGAGGAGCUU
Get precursor sequence
Structure
        10           20        30        40        50          
AAACGCAAGGAUUGAGG---|   U    G   UC               G     GUGUAU 
                    AAGU AGUU UUA  UUUGGUUAUCUAGCU UAUGA      \
                    UUCG UCAA AAU  AAGCCAAUAGAUCGA AUACU      U
UUCGAGGAGCUUCUGGGAUC^   -    A   GA               A     GCCCGU 
 .       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-9-P2_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Sto-Mir-9-P2_3p*

MirBase accessionNone
Sequence
38- AUAAAGCUAGAUAACCGAAAGUA -61
Get sequence