MirGeneDB

MirGeneDB ID

Cfa-Mir-9-P2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-9-2
Paralogues Cfa-Mir-9-P1  Cfa-Mir-9-P3 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Sto-Mir-9-P2  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(canFam3)
chr3: 19997697-19997755 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGAGGCGUGUGAGGGAAGUGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCAAGAUCGCCGGGGAGCAU
Get precursor sequence
Structure
        10          20        30        40        50         
ACAGAGGCGUGUGAGGG--|  U     G   UC               G     GUGUA 
                   AAG GAGUU UUA  UUUGGUUAUCUAGCU UAUGA     U
                   UUC CUCAA AAU  AAGCCAAUAGAUCGA AUACU     U
UACGAGGGGCCGCUAGAAC^  -     A   GA               A     UCUGG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Mature sequence

Cfa-Mir-9-P2_5p

MirBase accessionMIMAT0006674
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets TargetScanVert: cfa-miR-9
miRDB: MIMAT0006674
Co-mature sequence

Cfa-Mir-9-P2_3p

MirBase accessionNone
Sequence
37- AUAAAGCUAGAUAACCGAAAGU -59
Get sequence