MirGeneDB

MirGeneDB ID

Aca-Mir-9-P2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-9-1
Paralogues Aca-Mir-9-P3  Aca-Mir-9-P4 
Orthologues Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Sto-Mir-9-P2  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
2: 21613005-21613064 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCGGAUCACACGAGGGAAGCGAGUUGUUGUCUUUGGUUAUCUAGCUGUAUGAGUGUGUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCAUGAUCUUCAUGCUGCACA
Get precursor sequence
Structure
        10           20        30        40        50         
UUCGGAUCACACGAGGG---|  C     G   UC               G     GUGUG 
                    AAG GAGUU UUG  UUUGGUUAUCUAGCU UAUGA     U
                    UUC CUCAA AAU  AAGCCAAUAGAUCGA AUACU     U
ACACGUCGUACUUCUAGUAC^  -     A   GA               A     UCUGG 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-9-P2_5p

MirBase accessionMIMAT0021990
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Aca-Mir-9-P2_3p*

MirBase accessionMIMAT0021991
Sequence
37- AUAAAGCUAGAUAACCGAAAGUA -60
Get sequence