MirGeneDB

MirGeneDB ID

Sha-Mir-9-P2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID sha-mir-9
Paralogues Sha-Mir-9-P1  Sha-Mir-9-P3  Sha-Mir-9-P4 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Spu-Mir-9  Sto-Mir-9-P2  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(DEVIL7_traces)
GL841279.1: 926547-926606 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAAAGUCUUGUGAGGGAAGUGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCAAGAUCUUCGAGGAGCGUA
Get precursor sequence
Structure
        10           20        30        40        50         
GCAAAGUCUUGUGAGGG---|  U     G   UC               G    AGUGUA 
                    AAG GAGUU UUA  UUUGGUUAUCUAGCU UAUG      U
                    UUC CUCAA AAU  AAGCCAAUAGAUCGA AUAC      U
AUGCGAGGAGCUUCUAGAAC^  -     A   GA               A    UUCUGG 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Mature sequence

Sha-Mir-9-P2_5p

MirBase accessionMIMAT0022783
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Star sequence

Sha-Mir-9-P2_3p*

MirBase accessionNone
Sequence
38- UAAAGCUAGAUAACCGAAAGUA -60
Get sequence