MirGeneDB

MirGeneDB ID

Sha-Mir-9-P3

Family name MIR-9 (all species)
Seed CUUUGGU
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-9-P1  Sha-Mir-9-P2  Sha-Mir-9-P4 
Orthologues Aca-Mir-9-P3  Ami-Mir-9-P3  Bta-Mir-9-P3  Cfa-Mir-9-P3  Cin-Mir-9  Cpi-Mir-9-P3  Cpo-Mir-9-P3  Cte-Mir-9  Dno-Mir-9-P3  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Ete-Mir-9-P3  Gga-Mir-9-P3  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P3  Mml-Mir-9-P3  Mmu-Mir-9-P3  Oan-Mir-9-P3  Ocu-Mir-9-P3  Pmi-Mir-9  Rno-Mir-9-P3  Spu-Mir-9  Sto-Mir-9-P3  Tgu-Mir-9-P3  Xtr-Mir-9-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(DEVIL7_traces)
GL834472.1: 1703520-1703581 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGGCCUACGGGAUCGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGUUAUUGAGCUAUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGACUUUCACAACUUCUCCGAGCUGG
Get precursor sequence
Structure
        10        20           30        40        50        60
GGGGGCCUACGGGAUCGAGGCC--       -| C               G    AGUGUUA 
                        CGUUUCU CU UUUGGUUAUCUAGCU UAUG       U
                        GUAAAGA GA AAGCCAAUAGAUCGA AUAC       U
GGUCGAGCCUCUUCAACACUUUCA       U^ -               A    UAUCGAG 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Mature sequence

Sha-Mir-9-P3_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Star sequence

Sha-Mir-9-P3_3p*

MirBase accessionNone
Sequence
40- UAAAGCUAGAUAACCGAAAGUA -62
Get sequence