MirGeneDB

MirGeneDB ID

Bta-Mir-9-P3

Family name MIR-9 (all species)
Seed CUUUGGU
Species Cow (Bos taurus)
MiRBase ID bta-mir-9-1
Paralogues Bta-Mir-9-P1  Bta-Mir-9-P2 
Orthologues Aca-Mir-9-P3  Ami-Mir-9-P3  Cfa-Mir-9-P3  Cin-Mir-9  Cpi-Mir-9-P3  Cpo-Mir-9-P3  Cte-Mir-9  Dno-Mir-9-P3  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Ete-Mir-9-P3  Gga-Mir-9-P3  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P3  Mml-Mir-9-P3  Mmu-Mir-9-P3  Oan-Mir-9-P3  Ocu-Mir-9-P3  Pmi-Mir-9  Rno-Mir-9-P3  Sha-Mir-9-P3  Spu-Mir-9  Sto-Mir-9-P3  Tgu-Mir-9-P3  Xtr-Mir-9-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr21: 21250116-21250177 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGCGGUGGCGAAGGGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAGCCGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGACUCUCACAACUUCUGCGUGCGAG
Get precursor sequence
Structure
        10          20         30        40        50        60
GCGGCGGUGGCGAAGGG--   CC       -| C               G     GUGCCA 
                   AGG  CGUUUCU CU UUUGGUUAUCUAGCU UAUGA      C
                   UCU  GUAAAGA GA AAGCCAAUAGAUCGA AUACU      A
GAGCGUGCGUCUUCAACAC   CA       U^ -               A     GCCGAG 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-9-P3_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Bta-Mir-9-P3_3p*

MirBase accessionMIMAT0012549
Sequence
39- AUAAAGCUAGAUAACCGAAAGUA -62
Get sequence
Validated targets TargetScanVert: bta-miR-9-3p