MirGeneDB

MirGeneDB ID

Mml-Mir-9-P3

Family name MIR-9 (all species)
Seed CUUUGGU
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-9-3
Paralogues Mml-Mir-9-P1  Mml-Mir-9-P2 
Orthologues Aca-Mir-9-P3  Ami-Mir-9-P3  Bta-Mir-9-P3  Cfa-Mir-9-P3  Cin-Mir-9  Cpi-Mir-9-P3  Cpo-Mir-9-P3  Cte-Mir-9  Dno-Mir-9-P3  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Ete-Mir-9-P3  Gga-Mir-9-P3  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P3  Mmu-Mir-9-P3  Oan-Mir-9-P3  Ocu-Mir-9-P3  Pmi-Mir-9  Rno-Mir-9-P3  Sha-Mir-9-P3  Spu-Mir-9  Sto-Mir-9-P3  Tgu-Mir-9-P3  Xtr-Mir-9-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rheMac8)
chr7: 67381836-67381896 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGCAGUGGCGAAGGGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAGCCGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGACUCUCACAACUUCUGCGUGCGA
Get precursor sequence
Structure
        10         20         30        40        50        60
GCGGCAGUGGCGAAGGG-   CC       -| C               G     GUGCCA 
                  AGG  CGUUUCU CU UUUGGUUAUCUAGCU UAUGA      C
                  UCU  GUAAAGA GA AAGCCAAUAGAUCGA AUACU      A
AGCGUGCGUCUUCAACAC   CA       U^ -               A     GCCGAG 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Mature sequence

Mml-Mir-9-P3_5p

MirBase accessionMIMAT0006160
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets TargetScanVert: mml-miR-9-5p
Star sequence

Mml-Mir-9-P3_3p*

MirBase accessionMIMAT0031078
Sequence
39- AUAAAGCUAGAUAACCGAAAGU -61
Get sequence
Validated targets TargetScanVert: mml-miR-9-3-3p