MirGeneDB

MirGeneDB ID

Cli-Mir-9-P4

Family name MIR-9 (all species)
Seed CUUUGGU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-9-3
Paralogues Cli-Mir-9-P1  Cli-Mir-9-P2 
Orthologues Aca-Mir-9-P4  Ami-Mir-9-P4  Cin-Mir-9  Cpi-Mir-9-P4  Cte-Mir-9  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4  Xtr-Mir-9-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold194: 244986-245046 [+]
Precursor
(pre-Mir +30nt flank)
CCAUUUUAUAAAGACCUGGGUUGGUUUUUCUCUUUGGUUAUCUAGCUGUAUGAGUGUAUGUGAUAUCAUAAAGCUAGAGAACCGAAUGUAAAAACCCGCUCGCUGUUCUCCGGGAGAAAAG
Get precursor sequence
Structure
        10           20        30        40        50         
CCAUUUUAUAAAGACCU---|   U       CUC       A       G    AGUGUA 
                    GGGU GGUUUUU   UUUGGUU UCUAGCU UAUG      U
                    CUCG CCAAAAA   AAGCCAA AGAUCGA AUAC      G
GAAAAGAGGGCCUCUUGUCG^   C       UGU       G       A    UAUAGU 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-9-P4_5p

MirBase accessionMIMAT0038401
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Co-mature sequence

Cli-Mir-9-P4_3p

MirBase accessionMIMAT0038403
Sequence
38- UAAAGCUAGAGAACCGAAUGUAA -61
Get sequence