MirGeneDB

MirGeneDB ID

Xtr-Mir-9-P1

Family name MIR-9 (all species)
Seed CUUUGGU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-9a-1
Paralogues Xtr-Mir-9-P2  Xtr-Mir-9-P3  Xtr-Mir-9-P4 
Orthologues Ami-Mir-9-P1  Bta-Mir-9-P1  Cfa-Mir-9-P1  Cin-Mir-9  Cli-Mir-9-P1  Cpi-Mir-9-P1  Cpo-Mir-9-P1  Cte-Mir-9  Dno-Mir-9-P1  Dre-Mir-9-P1  Ete-Mir-9-P1  Gga-Mir-9-P1  Hsa-Mir-9-P1  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P1  Mml-Mir-9-P1  Mmu-Mir-9-P1  Oan-Mir-9-P1-v1  Oan-Mir-9-P1-v2  Ocu-Mir-9-P1  Pmi-Mir-9  Rno-Mir-9-P1  Sha-Mir-9-P1  Spu-Mir-9 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(xenTro7)
KB021660: 4935875-4935935 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GGUGGUGGGAUGAACAGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUUGUCAAUCCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCAUUACACUCCUUGGCGCU
Get precursor sequence
Structure
        10          20        30        40        50        60
GGUGGUGGGAUGAACAG--|     GUUG   UC               G     GUGUUG 
                   GGGUUG    UUA  UUUGGUUAUCUAGCU UAUGA      U
                   CCCAAU    AAU  AAGCCAAUAGAUCGA AUACU      C
UCGCGGUUCCUCACAUUAC^     AAA-   GA               A     UCCUAA 
 .       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-9-P1_5p

MirBase accessionMIMAT0003553
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets TargetScanVert: xtr-miR-9a-5p
Co-mature sequence

Xtr-Mir-9-P1_3p

MirBase accessionMIMAT0003554
Sequence
39- AUAAAGCUAGAUAACCGAAAGU -61
Get sequence
Validated targets TargetScanVert: xtr-miR-9a-3p