MirGeneDB

MirGeneDB ID

Mdo-Mir-9-P1

Family name MIR-9 (all species)
Seed CUUUGGU
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-9a-3
Paralogues Mdo-Mir-9-P2  Mdo-Mir-9-P3  Mdo-Mir-9-P4 
Orthologues Ami-Mir-9-P1  Bta-Mir-9-P1  Cfa-Mir-9-P1  Cin-Mir-9  Cli-Mir-9-P1  Cpi-Mir-9-P1  Cpo-Mir-9-P1  Cte-Mir-9  Dno-Mir-9-P1  Dre-Mir-9-P1  Ete-Mir-9-P1  Gga-Mir-9-P1  Hsa-Mir-9-P1  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mml-Mir-9-P1  Mmu-Mir-9-P1  Oan-Mir-9-P1-v1  Oan-Mir-9-P1-v2  Ocu-Mir-9-P1  Pmi-Mir-9  Rno-Mir-9-P1  Sha-Mir-9-P1  Spu-Mir-9  Xtr-Mir-9-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(monDom5)
2: 191328853-191328914 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGCAGCCGGGAGGCGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUCGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCAUACACUGCGGAGCACGAG
Get precursor sequence
Structure
        10           20        30        40        50        60
GCUGCAGCCGGGAGGCG---|     GUUG   UC               G    AGUGGUG 
                    GGGUUG    UUA  UUUGGUUAUCUAGCU UAUG       U
                    CCCAAU    AAU  AAGCCAAUAGAUCGA AUAC       C
GAGCACGAGGCGUCACAUAC^     AAA-   GA               A    UUCUGAG 
120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Mdo-Mir-9-P1_5p

MirBase accessionMIMAT0004087
Sequence
0- UCUUUGGUUAUCUAGCUGUAUG -22
Get sequence
Validated targets TargetScanVert: mdo-miR-9a-5p
Star sequence

Mdo-Mir-9-P1_3p*

MirBase accessionMIMAT0004088
Sequence
40- UAAAGCUAGAUAACCGAAAGUA -62
Get sequence
Validated targets TargetScanVert: mdo-miR-9a-3p