MirGeneDB

MirGeneDB ID

Ete-Mir-9-P1

Family name MIR-9 (all species)
Seed CUUUGGU
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-9-P2  Ete-Mir-9-P3 
Orthologues Ami-Mir-9-P1  Bta-Mir-9-P1  Cfa-Mir-9-P1  Cin-Mir-9  Cli-Mir-9-P1  Cpi-Mir-9-P1  Cpo-Mir-9-P1  Cte-Mir-9  Dno-Mir-9-P1  Dre-Mir-9-P1  Gga-Mir-9-P1  Hsa-Mir-9-P1  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P1  Mml-Mir-9-P1  Mmu-Mir-9-P1  Oan-Mir-9-P1-v1  Oan-Mir-9-P1-v2  Ocu-Mir-9-P1  Pmi-Mir-9  Rno-Mir-9-P1  Sha-Mir-9-P1  Spu-Mir-9  Xtr-Mir-9-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(echTel2)
JH980385: 3055614-3055674 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GCGGCGGCCAGGAGGCGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCAUACACUGCGCAGAGGGC
Get precursor sequence
Structure
        10          20        30        40        50        60
GCGGCGGCCAGGAGGCG--|     GUUG   UC               G     GUGGUG 
                   GGGUUG    UUA  UUUGGUUAUCUAGCU UAUGA      U
                   CCCAAU    AAU  AAGCCAAUAGAUCGA AUACU      G
CGGGAGACGCGUCACAUAC^     AAA-   GA               A     UCUGAG 
 .       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Ete-Mir-9-P1_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Ete-Mir-9-P1_3p*

MirBase accessionNone
Sequence
39- AUAAAGCUAGAUAACCGAAAGU -61
Get sequence