MirGeneDB

MirGeneDB ID

Asu-Mir-9-o17

Family name MIR-9 (all species)
Seed CUUUGGU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-9
Paralogues Asu-Mir-9-o18-v1  Asu-Mir-9-o18-v2 
Orthologues Cbr-Mir-9-P17  Cel-Mir-9-P17  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) A. suum
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold703: 302189-302252 [+]
Precursor
(pre-Mir +30nt flank)
UGCACAGGUUUUUCAUCGCAGUUGGCAAUUUCUUUGGUUAUCUAGCUGUAUGAGUACCGCGUUUAGUCGUCAUAAAGCUGGACGACCGAAGUAAUGGCCGCUGAUCGUAUGCCAUAUCCGACAU
Get precursor sequence
Structure
        10           20        30        40        50        60 
UGCACAGGUUUUUCAUCG---|   U   A   U       UA       G     GUACCGC 
                     CAGU GGC AUU CUUUGGU  UCUAGCU UAUGA       G
                     GUCG CCG UAA GAAGCCA  AGGUCGA AUACU       U
UACAGCCUAUACCGUAUGCUA^   -   G   U       GC       A     GCUGAUU 
  120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-9-o17_5p

MirBase accessionMIMAT0021431
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Asu-Mir-9-o17_3p*

MirBase accessionMIMAT0021432
Sequence
41- AUAAAGCUGGACGACCGAAGUAA -64
Get sequence