MirGeneDB

MirGeneDB ID

Dan-Mir-9-P11

Family name MIR-9 (all species)
Seed UAAAGCU
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-4
Paralogues Dan-Mir-9-P7  Dan-Mir-9-P8  Dan-Mir-9-P9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2 
Orthologues Bge-Mir-9-o11  Cin-Mir-9  Cte-Mir-9  Dme-Mir-9-P11  Dmo-Mir-9-P11  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13266: 9731536-9731592 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P11)
Mir-3-P2 scaffold_13266: 9731119-9731176 [+] Ensembl
Mir-3-P1 scaffold_13266: 9731233-9731293 [+] Ensembl
Mir-279-P2 scaffold_13266: 9731371-9731449 [+] Ensembl
Mir-9-P11 scaffold_13266: 9731536-9731592 [+] Ensembl
Mir-2-P5 scaffold_13266: 9731684-9731746 [+] Ensembl
Mir-2-P6a scaffold_13266: 9731826-9731883 [+] Ensembl
Mir-2-P6b scaffold_13266: 9731970-9732041 [+] Ensembl
Mir-2-P6c scaffold_13266: 9732130-9732191 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUACCAAUAUAAAGGUUGCAAUUAGUUUCUUUGGUCGUCCAGCCUUAGGUGACUUCUCUGAUCAUAAAGCUAGACAACCAUUGAAGUUCGUUGUGGCAAUUGCGGCGCUUAUUAA
Get precursor sequence
Structure
        10          20        30        40        50         
AUAUACCAAUAUAAAGG--|UG    U GU   UU    C   C   CUUAG    CUUC 
                   U  CAAU A  UUC  UGGU GUC AGC     GUGA    \
                   G  GUUG U  AAG  ACCA CAG UCG     UACU    U
AAUUAUUCGCGGCGUUAAC^GU    C UG   UU    A   A   AAA--    AGUC 
     110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-9-P11_5p*

MirBase accessionNone
Sequence
0- CUUUGGUCGUCCAGCCUUAGGUGA -24
Get sequence
Mature sequence

Dan-Mir-9-P11_3p

MirBase accessionMIMAT0008427
Sequence
35- AUAAAGCUAGACAACCAUUGAA -57
Get sequence