MirGeneDB

MirGeneDB ID

Dan-Mir-9-P9

Family name MIR-9 (all species)
Seed CUUUGGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-9c
Paralogues Dan-Mir-9-P7  Dan-Mir-9-P8  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dan-Mir-9-P11 
Orthologues Aae-Mir-9-P9  Cin-Mir-9  Cte-Mir-9  Dme-Mir-9-P9  Dmo-Mir-9-P9  Hme-Mir-9-o9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Diptera
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12916: 15865484-15865553 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-9-P9)
Mir-9-P8 scaffold_12916: 15864555-15864614 [-] Ensembl
Mir-9-P10-v1 scaffold_12916: 15864734-15864795 [-] Ensembl
Mir-9-P10-v2 scaffold_12916: 15864734-15864795 [-] Ensembl
Mir-306 scaffold_12916: 15864875-15864933 [-] Ensembl
Mir-9-P9 scaffold_12916: 15865484-15865553 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CACGCACUCCCUUUCAUUAUUUUUGCUGUUUCUUUGGUAUUCUAGCUGUAGAUUGUUUCACGCACAUUGUAUAUCAUCUAAAGCUUUUAUACCAAAGCUCCAGCUUAAAUUGCUUAACAACGCACCAACA
Get precursor sequence
Structure
        10          20        30        40        50        60    
CACGCACUCCCUUUCAUU--|   UU    UUU         UCU    G    UUGUUUCACGC 
                    AUUU  GCUG   CUUUGGUAU   AGCU UAGA           A
                    UAAA  CGAC   GAAACCAUA   UCGA AUCU           C
ACAACCACGCAACAAUUCGU^   UU    CUC         UUU    A    ACUAUAUGUUA 
.       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-9-P9_5p

MirBase accessionMIMAT0008456
Sequence
0- UCUUUGGUAUUCUAGCUGUAGA -22
Get sequence
Star sequence

Dan-Mir-9-P9_3p*

MirBase accessionNone
Sequence
48- UAAAGCUUUUAUACCAAAGCUC -70
Get sequence