MirGeneDB

MirGeneDB ID

Dan-Mir-2-P6a

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-6-1
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Dme-Mir-2-P6a  Dmo-Mir-2-P6a  Dpu-Mir-2-o6 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13266: 9731826-9731883 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P6a)
Mir-3-P2 scaffold_13266: 9731119-9731176 [+] Ensembl
Mir-3-P1 scaffold_13266: 9731233-9731293 [+] Ensembl
Mir-279-P2 scaffold_13266: 9731371-9731449 [+] Ensembl
Mir-9-P11 scaffold_13266: 9731536-9731592 [+] Ensembl
Mir-2-P5 scaffold_13266: 9731684-9731746 [+] Ensembl
Mir-2-P6a scaffold_13266: 9731826-9731883 [+] Ensembl
Mir-2-P6b scaffold_13266: 9731970-9732041 [+] Ensembl
Mir-2-P6c scaffold_13266: 9732130-9732191 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGACUCGCAGGAUACCCGCCUUUAAAGUAGAGAGAAUAGUGGCUGUGCUGUAAGUUUCAAAAUCUAUAUCACAGUGGCUGUUCUUUUUGCACCUAAAGUGCCAAACAGCCAAACCCGA
Get precursor sequence
Structure
        10         20         30        40        50        
GGACUCGCAGGAUACCCGC-     AA-|             G      C    AGUUU 
                    CUUUA   GUAGAGAGAAUAGU GCUGUG UGUA     C
                    GAAAU   CGUUUUUCUUGUCG UGACAC AUAU     A
AGCCCAAACCGACAAACCGU     CCA^             G      U    CUAAA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P6a_5p*

MirBase accessionNone
Sequence
0- AGAGAAUAGUGGCUGUGCUGUA -22
Get sequence
Mature sequence

Dan-Mir-2-P6a_3p

MirBase accessionMIMAT0008462
Sequence
36- UAUCACAGUGGCUGUUCUUUUU -58
Get sequence