MirGeneDB

MirGeneDB ID

Dan-Mir-279-P1

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-279
Paralogues Dan-Mir-279-P2  Dan-Mir-279-P3 
Orthologues Aae-Mir-279-P1  Cgi-Mir-279  Dme-Mir-279-P1  Dmo-Mir-279-P1  Dpu-Mir-279-o1  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 14200323-14200386 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAUACUAAUACUACUACUACUACUGUUUUUAGUGGGUGAGGGUCCAGUGUUUCACAUUGAUUUCUGUAUUUGUGACUAGAUCCACACUCAUUAAUAACGGUAGUUCAAUCAGCAAGGCCCACGU
Get precursor sequence
Structure
        10          20        30        40        50        60   
GAUACUAAUACUACUACU--|        U          A     C  UGUU     UUGAUU 
                    ACUACUGUU UUAGUGGGUG GGGUC AG    UCACA      U
                    UGAUGGCAA AAUUACUCAC CCUAG UC    AGUGU      C
UGCACCCGGAACGACUAACU^        U          A     A  ----     UUAUGU 
  120       110       100        90        80            70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-279-P1_5p*

MirBase accessionNone
Sequence
0- AGUGGGUGAGGGUCCAGUGUUUCACA -26
Get sequence
Mature sequence

Dan-Mir-279-P1_3p

MirBase accessionMIMAT0008454
Sequence
42- UGACUAGAUCCACACUCAUUAA -64
Get sequence