MirGeneDB

MirGeneDB ID

Isc-Mir-279

Family name MIR-279 (all species)
Seed GACUAGA
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-279
Paralogues
Orthologues Aae-Mir-279-o26  Aae-Mir-279-P1  Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Aae-Mir-279-P3  Asu-Mir-279-o26  Asu-Mir-279-o27  Asu-Mir-279-o28  Asu-Mir-279-o29  Asu-Mir-279-o30  Bge-Mir-279-o35  Bge-Mir-279-o36  Bge-Mir-279-o37  Bge-Mir-279-o38  Bge-Mir-279-o39  Cbr-Mir-279-o7  Cbr-Mir-279-o8a  Cbr-Mir-279-o8b  Cbr-Mir-279-o9  Cbr-Mir-279-o10  Cel-Mir-279-o7  Cel-Mir-279-o8  Cel-Mir-279-o9  Cel-Mir-279-o10  Cgi-Mir-279  Cte-Mir-279-o11  Cte-Mir-279-o12  Cte-Mir-279-o13  Dan-Mir-279-P1  Dan-Mir-279-P2  Dan-Mir-279-P3  Dme-Mir-279-P1  Dme-Mir-279-P2  Dme-Mir-279-P3  Dmo-Mir-279-P1  Dmo-Mir-279-P2  Dmo-Mir-279-P3  Dpu-Mir-279-o1  Dpu-Mir-279-o2  Dpu-Mir-279-o3  Dpu-Mir-279-o4  Dpu-Mir-279-o5  Dpu-Mir-279-o6  Efe-Mir-279-o14  Efe-Mir-279-o15  Efe-Mir-279-o16  Efe-Mir-279-o17  Efe-Mir-279-o18  Efe-Mir-279-o19  Efe-Mir-279-o20  Hme-Mir-279-o31  Hme-Mir-279-o32  Hme-Mir-279-o33  Hme-Mir-279-o34  Lan-Mir-279-o40  Lan-Mir-279-o41  Lgi-Mir-279  Tca-Mir-279-o21  Tca-Mir-279-o22  Tca-Mir-279-o23  Tca-Mir-279-o24  Tca-Mir-279-o25 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS634011: 38521-38578 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCCGGGGAGUCUUCUCUUUUCGUUGCUAUUGAUGACUGUGCCUCUAGUCCAUGUGAAUCUAGCUCAUGACUAGAUCCACACUCAUCCAUAGAAGCGGAACUUUGUCGUCCGAUCGCCG
Get precursor sequence
Structure
        10          20        30        40        50         
GCCGGGGAGUCUUCUCU--|      G    U     C    CC       C   UGAAU 
                   UUUCGUU CUAU GAUGA UGUG  UCUAGUC AUG     \
                   AAGGCGA GAUA CUACU ACAC  AGAUCAG UAC     C
GCCGCUAGCCUGCUGUUUC^      A    C     C    CU       -   UCGAU 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-279_5p*

MirBase accessionNone
Sequence
0- GAUGACUGUGCCUCUAGUCCAUG -23
Get sequence
Mature sequence

Isc-Mir-279_3p

MirBase accessionMIMAT0012694
Sequence
36- UGACUAGAUCCACACUCAUCCA -58
Get sequence