MirGeneDB ID | Snu-Mir-279-o51 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Snu-Mir-279-o50 Snu-Mir-279-o52 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Agr-Mir-279 Bpl-Mir-279 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gsa-Mir-279 Gsp-Mir-279 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | S. nudus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049310.1: 58913018-58913073 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-279-o51) |
Mir-279-o51
CM049310.1: 58913018-58913073 [+]
Mir-36 CM049310.1: 58918107-58918165 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GUCGUUGAGGUUUUUACCGCUGGGACUAGGAUGGCUGUGUGUCUGGUCCAUGUGUUUCUAUAUCAUGACUAGAUCCACACUCAUCCCGGUCAGCGGGAUCACACGUGAUGACCAGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GUCGUUGAGGUUUUUAC----| GG UA GC UG C UGUUU CGCU GAC GGAUG UGUG UCUGGUC AUG \ GCGA CUG CCUAC ACAC AGAUCAG UAC C CGACCAGUAGUGCACACUAGG^ -- GC UC CU - UAUAU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of annelids thus these multiple paralogues are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Snu-Mir-279-o51_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AUGGCUGUGUGUCUGGUCCAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Snu-Mir-279-o51_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
35- UGACUAGAUCCACACUCAUCC -56
Get sequence
|