MirGeneDB

MirGeneDB ID

Dmo-Mir-279-P2

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-286
Paralogues Dmo-Mir-279-P1  Dmo-Mir-279-P3 
Orthologues Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Cgi-Mir-279  Dan-Mir-279-P2  Dme-Mir-279-P2  Dpu-Mir-279-o2  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6496: 20936799-20936877 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P2)
Mir-2-P6c scaffold_6496: 20935964-20936029 [-] Ensembl
Mir-2-P6b scaffold_6496: 20936142-20936210 [-] Ensembl
Mir-2-P6a scaffold_6496: 20936318-20936375 [-] Ensembl
Mir-2-P5 scaffold_6496: 20936469-20936531 [-] Ensembl
Mir-9-P11 scaffold_6496: 20936638-20936694 [-] Ensembl
Mir-279-P2 scaffold_6496: 20936799-20936877 [-] Ensembl
Mir-3-P1 scaffold_6496: 20936995-20937055 [-] Ensembl
Mir-3-P2 scaffold_6496: 20937123-20937187 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCGAAAAUUAUAAAAUUUUAAAAUUAAAUGGCGAUUGUCGGUAUGGUCUCUUUUUCAACAUAUACACCAAACAUUCUAUAUAAAGUGACUAGACCGAACACUCGUGCUAUAAUUUUAAAAUGUUCAACAAUUUCAAUU
Get precursor sequence
Structure
        10          20        30         40        50        60        
UUCGAAAAUUAUAAAAU--          AAUG    U  -|    A     U  UUUUCAACAUAUACA 
                   UUUAAAAUUA    GCGA UG UCGGU UGGUC CU               C
                   AAAUUUUAAU    UGCU AC AGCCA AUCAG GA               C
UUAACUUUAACAACUUGUA          AUCG    C  A^    G     U  AAUAUAUCUUACAAA 
       130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-279-P2_5p*

MirBase accessionNone
Sequence
0- GGCGAUUGUCGGUAUGGUCUCU -22
Get sequence
Mature sequence

Dmo-Mir-279-P2_3p

MirBase accessionMIMAT0008643
Sequence
56- UGACUAGACCGAACACUCGUGCU -79
Get sequence