MirGeneDB

MirGeneDB ID

Dan-Mir-279-P2

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-286
Paralogues Dan-Mir-279-P1  Dan-Mir-279-P3 
Orthologues Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Cgi-Mir-279  Dme-Mir-279-P2  Dmo-Mir-279-P2  Dpu-Mir-279-o2  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13266: 9731371-9731449 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P2)
Mir-3-P2 scaffold_13266: 9731119-9731176 [+] Ensembl
Mir-3-P1 scaffold_13266: 9731233-9731293 [+] Ensembl
Mir-279-P2 scaffold_13266: 9731371-9731449 [+] Ensembl
Mir-9-P11 scaffold_13266: 9731536-9731592 [+] Ensembl
Mir-2-P5 scaffold_13266: 9731684-9731746 [+] Ensembl
Mir-2-P6a scaffold_13266: 9731826-9731883 [+] Ensembl
Mir-2-P6b scaffold_13266: 9731970-9732041 [+] Ensembl
Mir-2-P6c scaffold_13266: 9732130-9732191 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUUUUUAGCAUCAGAAUUUUAAAAUUGAAUGGCGAUUGUCGGUAUGGUCGCUUUUUCACAAAAAAAUUGGUUACCAACAAGCGAAGUGACUAGACCGAACACUCGUGCUAUAAUUUUAAAAUGUUCAUCAAGCUAAAGU
Get precursor sequence
Structure
        10          20        30         40        50        60        
AUUUUUAGCAUCAGAAU--          AAUG    U  -|    A        UUUUCACAAAAAAAU 
                   UUUAAAAUUG    GCGA UG UCGGU UGGUCGCU               U
                   AAAUUUUAAU    UGCU AC AGCCA AUCAGUGA               G
UGAAAUCGAACUACUUGUA          AUCG    C  A^    G        AGCGAACAACCAUUG 
       130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-279-P2_5p*

MirBase accessionNone
Sequence
0- GGCGAUUGUCGGUAUGGUCGCU -22
Get sequence
Mature sequence

Dan-Mir-279-P2_3p

MirBase accessionMIMAT0008444
Sequence
56- UGACUAGACCGAACACUCGUGCU -79
Get sequence