MirGeneDB

MirGeneDB ID

Dme-Mir-279-P2

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-286
Paralogues Dme-Mir-279-P1  Dme-Mir-279-P3 
Orthologues Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Cgi-Mir-279  Dan-Mir-279-P2  Dmo-Mir-279-P2  Dpu-Mir-279-o2  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(dm6)
chr2R: 19661435-19661509 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P2)
Mir-2-P6c chr2R: 19660722-19660787 [-] UCSC Ensembl
Mir-2-P6b chr2R: 19660874-19660935 [-] UCSC Ensembl
Mir-2-P6a chr2R: 19661012-19661074 [-] UCSC Ensembl
Mir-2-P5 chr2R: 19661162-19661222 [-] UCSC Ensembl
Mir-9-P11 chr2R: 19661300-19661356 [-] UCSC Ensembl
Mir-279-P2 chr2R: 19661435-19661509 [-] UCSC Ensembl
Mir-3-P1 chr2R: 19661600-19661656 [-] UCSC Ensembl
Mir-3-P2 chr2R: 19661710-19661768 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUUGGGCACUCCAGUUUUAAAAUUGAAUGGCGAAUGUCGGUAUGGUCUCUUUUUCAAAGAAAGGUUUCGAUUAAGCGAAGUGACUAGACCGAACACUCGUGCUAUAAUUUUAAAAUAUUCAACAUGCUCAGUA
Get precursor sequence
Structure
        10          20        30         40        50        60      
AUAUUGGGCACUCCAGU--          AAUG    A  -|    A     U  UUUUCAAAGAAAG 
                   UUUAAAAUUG    GCGA UG UCGGU UGGUC CU             G
                   AAAUUUUAAU    UGCU AC AGCCA AUCAG GA             U
AUGACUCGUACAACUUAUA          AUCG    C  A^    G     U  AGCGAAUUAGCUU 
   130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-279-P2_5p*

MirBase accessionMIMAT0020820
Sequence
0- GGCGAAUGUCGGUAUGGUCUCU -22
Get sequence
Mature sequence

Dme-Mir-279-P2_3p

MirBase accessionMIMAT0000359
Sequence
52- UGACUAGACCGAACACUCGUGCU -75
Get sequence
Validated targets microrna.org: MIMAT0000359
TargetScanFly: dme-miR-286