MirGeneDB

MirGeneDB ID

Dme-Mir-279-P3

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-996
Paralogues Dme-Mir-279-P1  Dme-Mir-279-P2 
Orthologues Aae-Mir-279-P3  Cgi-Mir-279  Dan-Mir-279-P3  Dmo-Mir-279-P3  Dpu-Mir-279-o3  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(dm6)
chr3R: 29217202-29217265 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P3)
Mir-279-P1 chr3R: 29215606-29215672 [+] UCSC Ensembl
Mir-279-P3 chr3R: 29217202-29217265 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGAUGCUCUUUUCUGACUCUAUUUUGUCGGCGAACAUGGAUCUAGUGCACGGUGGUUCAUGAUUAAGUUCGUGACUAGAUUUCAUGCUCGUCUAUUAAGUUGGGUCAGCACAACGAAGAGAGC
Get precursor sequence
Structure
        10          20        30         40        50        60 
AGGAUGCUCUUUUCUGA--   U    U  C     A    -|       G    GUGGUUCA 
                   CUC AUUU GU GGCGA CAUG GAUCUAGU CACG        U
                   GGG UGAA UA CUGCU GUAC UUAGAUCA GUGC        G
CGAGAGAAGCAACACGACU   U    U  U     C    U^       -    UUGAAUUA 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-279-P3_5p*

MirBase accessionMIMAT0020895
Sequence
0- GCGAACAUGGAUCUAGUGCACG -22
Get sequence
Mature sequence

Dme-Mir-279-P3_3p

MirBase accessionMIMAT0005515
Sequence
42- UGACUAGAUUUCAUGCUCGUCU -64
Get sequence
Validated targets microrna.org: MIMAT0005515
TargetScanFly: dme-miR-996