MirGeneDB

MirGeneDB ID

Aae-Mir-279-P3

Family name MIR-279 (all species)
Seed GACUAGA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-996
Paralogues Aae-Mir-279-o26  Aae-Mir-279-P1  Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2 
Orthologues Cgi-Mir-279  Dan-Mir-279-P3  Dme-Mir-279-P3  Dmo-Mir-279-P3  Dpu-Mir-279-o3  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.437: 567506-567574 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P3)
Mir-279-P3 supercont1.437: 567506-567574 [-] Ensembl
Mir-279-P1 supercont1.437: 572258-572322 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGCGGAGGAAGAAACUCAAUUUUCGUCGGCGUGCAUGAAUCUGGUGCACGGUUUUCCAGUUGUAAUAUCGCUUCGUGACUAGAUUACAUGCUCGUCUAUGAAGUUGAGAUCCGGCAACGCUACCAAG
Get precursor sequence
Structure
        10           20        30         40        50        60    
CCCGCGGAGGAAGAAAC---|      U   C    U     -        G    GUUUUCCAGUU 
                    UCAAUUU CGU GGCG GCAUG AAUCUGGU CACG           \
                    AGUUGAA GUA CUGC CGUAC UUAGAUCA GUGC           G
GAACCAUCGCAACGGCCUAG^      -   U    U     A        -    UUCGCUAUAAU 
       120       110        100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-279-P3_5p*

MirBase accessionNone
Sequence
0- GCGUGCAUGAAUCUGGUGCACG -22
Get sequence
Mature sequence

Aae-Mir-279-P3_3p

MirBase accessionMIMAT0014251
Sequence
47- UGACUAGAUUACAUGCUCGUCU -69
Get sequence