MirGeneDB

MirGeneDB ID

Dmo-Mir-279-P3

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues Dmo-Mir-279-P1  Dmo-Mir-279-P2 
Orthologues Aae-Mir-279-P3  Cgi-Mir-279  Dan-Mir-279-P3  Dme-Mir-279-P3  Dpu-Mir-279-o3  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6540: 26449303-26449366 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUUGCUCUUCUCUGACUCUAUUUUGUCGGCGAACAUGGAUCUAGUGCACGGUUGUUCAUGAUUAAGUUCGUGACUAGAUUUCAUGCUCGUCUAUUAAGUUGGGUCAAUACACACAGCGAAAA
Get precursor sequence
Structure
        10          20        30         40        50        60 
UUUUUGCUCUUCUCUGA--   U    U  C     A    -|       G    GUUGUUCA 
                   CUC AUUU GU GGCGA CAUG GAUCUAGU CACG        U
                   GGG UGAA UA CUGCU GUAC UUAGAUCA GUGC        G
AAAAGCGACACACAUAACU   U    U  U     C    U^       -    UUGAAUUA 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-279-P3_5p*

MirBase accessionNone
Sequence
0- GCGAACAUGGAUCUAGUGCACG -22
Get sequence
Mature sequence

Dmo-Mir-279-P3_3p

MirBase accessionNone
Sequence
42- UGACUAGAUUUCAUGCUCGUCU -64
Get sequence