MirGeneDB

MirGeneDB ID

Dme-Mir-279-P1

Family name MIR-279 (all species)
Seed GACUAGA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-279
Paralogues Dme-Mir-279-P2  Dme-Mir-279-P3 
Orthologues Aae-Mir-279-P1  Cgi-Mir-279  Dan-Mir-279-P1  Dmo-Mir-279-P1  Dpu-Mir-279-o1  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(dm6)
chr3R: 29215606-29215672 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P1)
Mir-279-P1 chr3R: 29215606-29215672 [+] UCSC Ensembl
Mir-279-P3 chr3R: 29217202-29217265 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGGAAUUGGAAUUCAUACUACUGUUUUUAGUGGGUGGGGGUCCAGUGUUUCACAUUGAUUUUCUUAGUAUUUGUGACUAGAUCCACACUCAUUAAUAACGGUAGUUCAAUCAUCAAGCACGUGUU
Get precursor sequence
Structure
        10          20        30        40        50        60     
GCUGGAAUUGGAAUUCAU--|        U          G     C  UGUU     UUGAUUUU 
                    ACUACUGUU UUAGUGGGUG GGGUC AG    UCACA        \
                    UGAUGGCAA AAUUACUCAC CCUAG UC    AGUGU        C
UUGUGCACGAACUACUAACU^        U          A     A  ----     UUAUGAUU 
     120       110       100        90        80            70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-279-P1_5p*

MirBase accessionMIMAT0020807
Sequence
0- AGUGGGUGGGGGUCCAGUGUUUCACA -26
Get sequence
Mature sequence

Dme-Mir-279-P1_3p

MirBase accessionMIMAT0000341
Sequence
45- UGACUAGAUCCACACUCAUUAA -67
Get sequence
Validated targets microrna.org: MIMAT0000341
TargetScanFly: dme-miR-279