MirGeneDB

MirGeneDB ID

Dme-Mir-2-P6c

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-6-3
Paralogues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dme-Mir-2-P2a  Dme-Mir-2-P2b  Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dme-Mir-2-P4a  Dme-Mir-2-P4b1  Dme-Mir-2-P4b2  Dme-Mir-2-P5  Dme-Mir-2-P6a  Dme-Mir-2-P6b  Dme-Mir-2-P7  Dme-Mir-2-P8  Dme-Mir-2-P9-v1  Dme-Mir-2-P9-v2 
Orthologues Dan-Mir-2-P6c  Dmo-Mir-2-P6c  Dpu-Mir-2-o6 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(dm6)
chr2R: 19660722-19660787 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P6c)
Mir-2-P6c chr2R: 19660722-19660787 [-] UCSC Ensembl
Mir-2-P6b chr2R: 19660874-19660935 [-] UCSC Ensembl
Mir-2-P6a chr2R: 19661012-19661074 [-] UCSC Ensembl
Mir-2-P5 chr2R: 19661162-19661222 [-] UCSC Ensembl
Mir-9-P11 chr2R: 19661300-19661356 [-] UCSC Ensembl
Mir-279-P2 chr2R: 19661435-19661509 [-] UCSC Ensembl
Mir-3-P1 chr2R: 19661600-19661656 [-] UCSC Ensembl
Mir-3-P2 chr2R: 19661710-19661768 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGCGAAAAUUGAAAAUUGUACAAAAAGAAGGGAACGGUUGCUGAUGAUGUAGUUUGAAACUCUCACAAUUUAUAUCACAGUGGCUGUUCUUUUUUGUUUGGCAAUCGAUCUACGUUCAGUGGUU
Get precursor sequence
Structure
        10           20        30        40        50        60   
AGUGCGAAAAUUGAAAA---|   A    A             UG   A       GUUUGAAAC 
                    UUGU CAAA AGAAGGGAACGGU  CUG UGAUGUA         \
                    AACG GUUU UUUUUUCUUGUCG  GAC ACUAUAU         U
UUGGUGACUUGCAUCUAGCU^   -    G             GU   -       UUAACACUC 
    120       110        100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-2-P6c_5p*

MirBase accessionMIMAT0020789
Sequence
0- AGGGAACGGUUGCUGAUGAUGUA -23
Get sequence
Mature sequence

Dme-Mir-2-P6c_3p

MirBase accessionMIMAT0000111
Sequence
44- UAUCACAGUGGCUGUUCUUUUU -66
Get sequence
Validated targets microrna.org: MIMAT0000111
TargetScanFly: dme-miR-6