MirGeneDB

MirGeneDB ID

Dme-Mir-2-P2a

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-2b-1
Paralogues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dme-Mir-2-P2b  Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dme-Mir-2-P4a  Dme-Mir-2-P4b1  Dme-Mir-2-P4b2  Dme-Mir-2-P5  Dme-Mir-2-P6a  Dme-Mir-2-P6b  Dme-Mir-2-P6c  Dme-Mir-2-P7  Dme-Mir-2-P8  Dme-Mir-2-P9-v1  Dme-Mir-2-P9-v2 
Orthologues Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dpu-Mir-2-o2 
Node of Origin (locus) D. melanogaster
Node of Origin (family) Protostomia
Genome context
(dm6)
chr2L: 8258623-8258684 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAAAUCAAAAUAACUAAAAACUUCAACUGUCUUCAAAGUGGCAGUGACAUGUUGUCAACAAUAUUCAUAUCACAGCCAGCUUUGAGGAGCGUUGCGGUUUUUCUCGUCCGGCGACUUAAG
Get precursor sequence
Structure
        10         20        30        40         50        60
UGCAAAUCAAAAUAACU-       U    UG         -|   A    C   UUGUCA 
                  AAAAACU CAAC  UCUUCAAAG UGGC GUGA AUG      A
                  UUUUUGG GUUG  AGGAGUUUC ACCG CACU UAC      C
GAAUUCAGCGGCCUGCUC       C    CG         G^   A    A   UUAUAA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-2-P2a_5p*

MirBase accessionMIMAT0020782
Sequence
0- GUCUUCAAAGUGGCAGUGACAUG -23
Get sequence
Mature sequence

Dme-Mir-2-P2a_3p

MirBase accessionMIMAT0000107
Sequence
39- UAUCACAGCCAGCUUUGAGGAGC -62
Get sequence
Validated targets microrna.org: MIMAT0000107
TargetScanFly: dme-miR-2b