MirGeneDB

MirGeneDB ID

Dme-Mir-2-P5

Family name MIR-2 (all species)
Seed AAGGAAC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-5
Paralogues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dme-Mir-2-P2a  Dme-Mir-2-P2b  Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dme-Mir-2-P4a  Dme-Mir-2-P4b1  Dme-Mir-2-P4b2  Dme-Mir-2-P6a  Dme-Mir-2-P6b  Dme-Mir-2-P6c  Dme-Mir-2-P7  Dme-Mir-2-P8  Dme-Mir-2-P9-v1  Dme-Mir-2-P9-v2 
Orthologues Dan-Mir-2-P5  Dmo-Mir-2-P5  Dpu-Mir-2-o5 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(dm6)
chr2R: 19661162-19661222 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P5)
Mir-2-P6c chr2R: 19660722-19660787 [-] UCSC Ensembl
Mir-2-P6b chr2R: 19660874-19660935 [-] UCSC Ensembl
Mir-2-P6a chr2R: 19661012-19661074 [-] UCSC Ensembl
Mir-2-P5 chr2R: 19661162-19661222 [-] UCSC Ensembl
Mir-9-P11 chr2R: 19661300-19661356 [-] UCSC Ensembl
Mir-279-P2 chr2R: 19661435-19661509 [-] UCSC Ensembl
Mir-3-P1 chr2R: 19661600-19661656 [-] UCSC Ensembl
Mir-3-P2 chr2R: 19661710-19661768 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGAUCCCCAAAUUCAUCGGGCCAUUCGCUAAAAGGAACGAUCGUUGUGAUAUGAGUUGUUUCCUAACAUAUCACAGUGAUUUUCCUUUAUAACGCAUGUUUAAAGUCCACAACUCAUCAAG
Get precursor sequence
Structure
        10        20          30         40        50          
UGAUCCCCAAAUUCAUCGGGC--   U  C  -|      C               AGUUGU 
                       CAU CG UA AAAGGAA GAUCGUUGUGAUAUG      \
                       GUA GC AU UUUCCUU UUAGUGACACUAUAC      U
GAACUACUCAACACCUGAAAUUU   C  A  A^      -               AAUCCU 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-2-P5_5p

MirBase accessionMIMAT0000110
Sequence
0- AAAGGAACGAUCGUUGUGAUAUG -23
Get sequence
Validated targets microrna.org: MIMAT0000110
TargetScanFly: dme-miR-5
Star sequence

Dme-Mir-2-P5_3p*

MirBase accessionMIMAT0020786
Sequence
38- UAUCACAGUGAUUUUCCUUUAUA -61
Get sequence