MirGeneDB

MirGeneDB ID

Dme-Mir-3-P2

Family name MIR-3 (all species)
Seed CACUGGG
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-309
Paralogues Dme-Mir-3-P1  Dme-Mir-3-P3 
Orthologues Aae-Mir-3-P2a1  Aae-Mir-3-P2a2  Aae-Mir-3-P2b  Bge-Mir-3-o2a-v1  Bge-Mir-3-o2a-v2  Bge-Mir-3-o2b-v1  Bge-Mir-3-o2b-v2  Dan-Mir-3-P2  Dmo-Mir-3-P2  Dpu-Mir-3  Hme-Mir-3-o2 
Node of Origin (locus) Drosophila
Node of Origin (family) Pancrustacea
Genome context
(dm6)
chr2R: 19661710-19661768 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-3-P2)
Mir-2-P6c chr2R: 19660722-19660787 [-] UCSC Ensembl
Mir-2-P6b chr2R: 19660874-19660935 [-] UCSC Ensembl
Mir-2-P6a chr2R: 19661012-19661074 [-] UCSC Ensembl
Mir-2-P5 chr2R: 19661162-19661222 [-] UCSC Ensembl
Mir-9-P11 chr2R: 19661300-19661356 [-] UCSC Ensembl
Mir-279-P2 chr2R: 19661435-19661509 [-] UCSC Ensembl
Mir-3-P1 chr2R: 19661600-19661656 [-] UCSC Ensembl
Mir-3-P2 chr2R: 19661710-19661768 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGUCUUAAAGUUUGGAAUAGCAAUUAUACGACAAACCUUGUUCGGUUUUGCCAAUUUCCAAGCCAGCACUGGGUAAAGUUUGUCCUAUAAUCCCGAAACGACGACCAGCUAAUUGUG
Get precursor sequence
Structure
        10        20          30        40        50         
GAAGUCUUAAAGUUUGGAAUAGCA--|     C       C   UU    U   CCAAUU 
                          AUUAUA GACAAAC UUG  CGGU UUG      \
                          UAAUAU CUGUUUG AAU  GUCA GAC      U
GUGUUAAUCGACCAGCAGCAAAGCCC^     C       A   GG    C   CGAACC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-3-P2_5p*

MirBase accessionMIMAT0020835
Sequence
0- CGACAAACCUUGUUCGGUUUUG -22
Get sequence
Mature sequence

Dme-Mir-3-P2_3p

MirBase accessionMIMAT0000401
Sequence
37- GCACUGGGUAAAGUUUGUCCUA -59
Get sequence
Validated targets microrna.org: MIMAT0000401
TargetScanFly: dme-miR-309