MirGeneDB

MirGeneDB ID

Dme-Mir-3-P1

Family name MIR-3 (all species)
Seed CACUGGG
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-3
Paralogues Dme-Mir-3-P2  Dme-Mir-3-P3 
Orthologues Dan-Mir-3-P1  Dmo-Mir-3-P1  Dpu-Mir-3  Hme-Mir-3-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Pancrustacea
Genome context
(dm6)
chr2R: 19661600-19661656 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-3-P1)
Mir-2-P6c chr2R: 19660722-19660787 [-] UCSC Ensembl
Mir-2-P6b chr2R: 19660874-19660935 [-] UCSC Ensembl
Mir-2-P6a chr2R: 19661012-19661074 [-] UCSC Ensembl
Mir-2-P5 chr2R: 19661162-19661222 [-] UCSC Ensembl
Mir-9-P11 chr2R: 19661300-19661356 [-] UCSC Ensembl
Mir-279-P2 chr2R: 19661435-19661509 [-] UCSC Ensembl
Mir-3-P1 chr2R: 19661600-19661656 [-] UCSC Ensembl
Mir-3-P2 chr2R: 19661710-19661768 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUUGUGAGCCACCUAAGGUCCCGAUCCUGGGAUGCAUCUUGUGCAGUUAUGUUUCAAUCUCACAUCACUGGGCAAAGUGUGUCUCAAGAUCCUGGCCACAUCGUCGCAACUUCAAA
Get precursor sequence
Structure
        10          20        30        40        50        
AAUUGUGAGCCACCUAA--|   CC    C         UC    G    U   UUUCA 
                   GGUC  GAUC UGGGAUGCA  UUGU CAGU AUG     \
                   CCGG  CUAG ACUCUGUGU  AACG GUCA UAC     A
AAACUUCAACGCUGCUACA^   UC    A         GA    G    C   ACUCU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-3-P1_5p*

MirBase accessionMIMAT0020784
Sequence
0- GGAUGCAUCUUGUGCAGUUAUG -22
Get sequence
Mature sequence

Dme-Mir-3-P1_3p

MirBase accessionMIMAT0000108
Sequence
35- UCACUGGGCAAAGUGUGUCUCA -57
Get sequence
Validated targets microrna.org: MIMAT0000108
TargetScanFly: dme-miR-3