MirGeneDB

MirGeneDB ID

Dmo-Mir-3-P1

Family name MIR-3 (all species)
Seed CACUGGG
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-3
Paralogues Dmo-Mir-3-P2  Dmo-Mir-3-P3 
Orthologues Dan-Mir-3-P1  Dme-Mir-3-P1  Dpu-Mir-3  Hme-Mir-3-o1 
Node of Origin (locus) Drosophila
Node of Origin (family) Pancrustacea
Genome context
(Dmoj_caf1)
scaffold_6496: 20936995-20937055 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-3-P1)
Mir-2-P6c scaffold_6496: 20935964-20936029 [-] Ensembl
Mir-2-P6b scaffold_6496: 20936142-20936210 [-] Ensembl
Mir-2-P6a scaffold_6496: 20936318-20936375 [-] Ensembl
Mir-2-P5 scaffold_6496: 20936469-20936531 [-] Ensembl
Mir-9-P11 scaffold_6496: 20936638-20936694 [-] Ensembl
Mir-279-P2 scaffold_6496: 20936799-20936877 [-] Ensembl
Mir-3-P1 scaffold_6496: 20936995-20937055 [-] Ensembl
Mir-3-P2 scaffold_6496: 20937123-20937187 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAACGGAACUCUCGCAGCUCUACUUUUGGGAUGCAUUUUGUGCAGAUGUCUAACGAUUGGAAACCCAUCACUGGGCAAAGUGUGUCUCAAAAUUGGGGCAACUAGCACAAAGGAGGAGU
Get precursor sequence
Structure
        10          20        30        40        50        60
UUCAACGGAACUCUCGCA--|     C                  G   A  UCUAACGAU 
                    GCUCUA UUUUGGGAUGCAUUUUGU CAG UG         U
                    CGGGGU AAAACUCUGUGUGAAACG GUC AC         G
UGAGGAGGAAACACGAUCAA^     U                  G   -  UACCCAAAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Em Fe Ma Ma
Star sequence

Dmo-Mir-3-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- GGAUGCAUUUUGUGCAGAUGUCU -23
Get sequence
Mature sequence

Dmo-Mir-3-P1_3p

MirBase accessionMIMAT0008668
Sequence
39- UCACUGGGCAAAGUGUGUCUCA -61
Get sequence