MirGeneDB

MirGeneDB ID

Dmo-Mir-2-P6c

Family name MIR-2 (all species)
Seed GAGAACG
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-6-3
Paralogues Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2  Dmo-Mir-2-P2b  Dmo-Mir-2-P3  Dmo-Mir-2-P4a  Dmo-Mir-2-P4b1  Dmo-Mir-2-P4b2  Dmo-Mir-2-P5  Dmo-Mir-2-P6a  Dmo-Mir-2-P6b  Dmo-Mir-2-P7  Dmo-Mir-2-P8  Dmo-Mir-2-P9 
Orthologues Dan-Mir-2-P6c  Dme-Mir-2-P6c  Dpu-Mir-2-o6 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6496: 20935964-20936029 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P6c)
Mir-2-P6c scaffold_6496: 20935964-20936029 [-] Ensembl
Mir-2-P6b scaffold_6496: 20936142-20936210 [-] Ensembl
Mir-2-P6a scaffold_6496: 20936318-20936375 [-] Ensembl
Mir-2-P5 scaffold_6496: 20936469-20936531 [-] Ensembl
Mir-9-P11 scaffold_6496: 20936638-20936694 [-] Ensembl
Mir-279-P2 scaffold_6496: 20936799-20936877 [-] Ensembl
Mir-3-P1 scaffold_6496: 20936995-20937055 [-] Ensembl
Mir-3-P2 scaffold_6496: 20937123-20937187 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAAAUCGUGGCCGUAAAUUGCUUAAAGAGAAGAGAACGUUCGCUGUUGAUGUAGUCGAAUUCAUUUAAUCUUUAUAUCACAGUGGCUGUUCUUUUUUGUUUAACAAUUUUUCAACGUUGAGAAUGA
Get precursor sequence
Structure
        10           20        30        40        50        60   
CAAAUCGUGGCCGUAAA---|  C     G           UU      U      GUCGAAUUC 
                    UUG UUAAA AGAAGAGAACG  CGCUGU GAUGUA         \
                    AAC AAUUU UUUUUUCUUGU  GUGACA CUAUAU         A
AGUAAGAGUUGCAACUUUUU^  -     G           CG      -      UUCUAAUUU 
    120       110        100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-2-P6c_5p

MirBase accessionNone
Sequence
0- AGAGAACGUUCGCUGUUGAUGUA -23
Get sequence
Star sequence

Dmo-Mir-2-P6c_3p*

MirBase accessionMIMAT0008635
Sequence
44- UAUCACAGUGGCUGUUCUUUUU -66
Get sequence