MirGeneDB

MirGeneDB ID

Dmo-Mir-2-P5

Family name MIR-2 (all species)
Seed AAGGAAC
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-5
Paralogues Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2  Dmo-Mir-2-P2b  Dmo-Mir-2-P3  Dmo-Mir-2-P4a  Dmo-Mir-2-P4b1  Dmo-Mir-2-P4b2  Dmo-Mir-2-P6a  Dmo-Mir-2-P6b  Dmo-Mir-2-P6c  Dmo-Mir-2-P7  Dmo-Mir-2-P8  Dmo-Mir-2-P9 
Orthologues Dan-Mir-2-P5  Dme-Mir-2-P5  Dpu-Mir-2-o5 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6496: 20936469-20936531 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P5)
Mir-2-P6c scaffold_6496: 20935964-20936029 [-] Ensembl
Mir-2-P6b scaffold_6496: 20936142-20936210 [-] Ensembl
Mir-2-P6a scaffold_6496: 20936318-20936375 [-] Ensembl
Mir-2-P5 scaffold_6496: 20936469-20936531 [-] Ensembl
Mir-9-P11 scaffold_6496: 20936638-20936694 [-] Ensembl
Mir-279-P2 scaffold_6496: 20936799-20936877 [-] Ensembl
Mir-3-P1 scaffold_6496: 20936995-20937055 [-] Ensembl
Mir-3-P2 scaffold_6496: 20937123-20937187 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUGCAAACUCGAUGAAUGGGCCAUGCGCUAAAAGGAACGAUCGUUGUGAUAUGCGUUAAUCGACCGUUACAUAUCACAGUGAUUUUCCUUUAUAGCGCGUGCAGUCCCCCAGACUACAAUAUG
Get precursor sequence
Structure
        10          20        30         40        50        60 
AUGCAAACUCGAUGAAUGG--| C        -       C               CGUUAAU 
                     GC AUGCGCUA AAAGGAA GAUCGUUGUGAUAUG       C
                     CG UGCGCGAU UUUCCUU UUAGUGACACUAUAC       G
GUAUAACAUCAGACCCCCUGA^ -        A       -               AUUGCCA 
 120       110        100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-2-P5_5p

MirBase accessionMIMAT0008691
Sequence
0- AAAGGAACGAUCGUUGUGAUAUG -23
Get sequence
Star sequence

Dmo-Mir-2-P5_3p*

MirBase accessionNone
Sequence
41- UAUCACAGUGAUUUUCCUUUAU -63
Get sequence