MirGeneDB

MirGeneDB ID

Dme-Mir-2-P9-v1

Family name MIR-2 (all species)
Seed UAAGGAA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-994
Paralogues Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dme-Mir-2-P2a  Dme-Mir-2-P2b  Dme-Mir-2-P3-v1  Dme-Mir-2-P3-v2  Dme-Mir-2-P4a  Dme-Mir-2-P4b1  Dme-Mir-2-P4b2  Dme-Mir-2-P5  Dme-Mir-2-P6a  Dme-Mir-2-P6b  Dme-Mir-2-P6c  Dme-Mir-2-P7  Dme-Mir-2-P8  Dme-Mir-2-P9-v2 
Orthologues Dan-Mir-2-P9  Dmo-Mir-2-P9  Isc-Mir-2-o9 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(dm6)
chr3R: 10408148-10408216 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-P9-v1)
Mir-2-P9-v1 chr3R: 10408148-10408216 [+] UCSC Ensembl
Mir-2-P9-v2 chr3R: 10408149-10408215 [+] UCSC Ensembl
Mir-3-P3 chr3R: 10408308-10408365 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGAUCGCGUCCUGAAUUUAUAUCGAGUUAUCUAAGGAAAUAGUAGCCGUGAUUUUACCCAAGAAUUUUUCACAUAUCACAGUUGCUGUUUCUUUUAGAUAGCUCUUUUGUAAACAGCCUAGAUCCGAAU
Get precursor sequence
Structure
        10         20         30         40        50        60   
CGAUCGCGUCCUGAAUU-    UC-         -|             C     UUUACCCAAG 
                  UAUA   GAGUUAUCU AAGGAAAUAGUAGC GUGAU          A
                  AUGU   CUCGAUAGA UUUCUUUGUCGUUG CACUA          A
UAAGCCUAGAUCCGACAA    UUU         U^             A     UACACUUUUU 
       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-2-P9-v1_5p

MirBase accessionMIMAT0005513
Sequence
0- CUAAGGAAAUAGUAGCCGUGAU -22
Get sequence
Validated targets microrna.org: MIMAT0005513
TargetScanFly: dme-miR-994
Star sequence

Dme-Mir-2-P9-v1_3p*

MirBase accessionMIMAT0020894
Sequence
46- CACAGUUGCUGUUUCUUUUAGAU -69
Get sequence