MirGeneDB

MirGeneDB ID

Dan-Mir-2-P9

Family name MIR-2 (all species)
Seed UAAGGAA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P7  Dan-Mir-2-P8 
Orthologues Dme-Mir-2-P9-v1  Dme-Mir-2-P9-v2  Dmo-Mir-2-P9  Isc-Mir-2-o9 
Node of Origin (locus) Drosophila
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 867382-867451 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GGUCAGGAAGCAAGAUUUAUAUCGAGUUAUCUAAGGAAAUAGUAGCCGUGAUUUUACCCUCGAAGUCAUUCCCAUAUCACAGUUGCUGUUUCUUUUAGAUAGCUCUUUUGUAAGCAGCCUAGAUUUCCAU
Get precursor sequence
Structure
        10         20         30         40        50        60    
GGUCAGGAAGCAAGAUU-    UC-         -|             C     UUUACCCUCGA 
                  UAUA   GAGUUAUCU AAGGAAAUAGUAGC GUGAU           \
                  AUGU   CUCGAUAGA UUUCUUUGUCGUUG CACUA           A
UACCUUUAGAUCCGACGA    UUU         U^             A     UACCCUUACUG 
.       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Mature sequence

Dan-Mir-2-P9_5p

MirBase accessionNone
Sequence
0- CUAAGGAAAUAGUAGCCGUGAU -22
Get sequence
Co-mature sequence

Dan-Mir-2-P9_3p

MirBase accessionNone
Sequence
47- CACAGUUGCUGUUUCUUUUAGAU -70
Get sequence