MirGeneDB

MirGeneDB ID

Dan-Mir-3-P3

Family name MIR-3 (all species)
Seed CACUGGG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-318
Paralogues Dan-Mir-3-P1  Dan-Mir-3-P2 
Orthologues Bge-Mir-3-o3-v1  Bge-Mir-3-o3-v2  Dme-Mir-3-P3  Dmo-Mir-3-P3  Dpu-Mir-3  Hme-Mir-3-o3 
Node of Origin (locus) Drosophila
Node of Origin (family) Pancrustacea
Genome context
(Dana_caf1)
scaffold_13340: 867217-867275 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCCCCAGGGUCCUCCGGUUUCAAUUUGUGGGAUACACACGGUUCAGUUGUGUCACUUUUGCGAGCAUCACUGGGCUUUGUUUAUCUCAUAAGACUGAAAUUUGUUCAACUUUACAUUC
Get precursor sequence
Structure
        10         20         30        40        50         
UUCCCCAGGGUCCUCCG-      A-|          C   C        U   UCACUU 
                  GUUUCA  UUUGUGGGAUA ACA GGUUCAGU GUG      \
                  UAAAGU  GAAUACUCUAU UGU UCGGGUCA UAC      U
CUUACAUUUCAACUUGUU      CA^          U   U        C   GAGCGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-3-P3_5p* (predicted)

MirBase accessionNone
Sequence
0- GGAUACACACGGUUCAGUUGUG -22
Get sequence
Mature sequence

Dan-Mir-3-P3_3p

MirBase accessionMIMAT0008463
Sequence
37- UCACUGGGCUUUGUUUAUCUCA -59
Get sequence