MirGeneDB

MirGeneDB ID

Dan-Mir-2-P7

Family name MIR-2 (all species)
Seed AUCACAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-11
Paralogues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dan-Mir-2-P2a-v1  Dan-Mir-2-P2a-v2  Dan-Mir-2-P2b  Dan-Mir-2-P3-v1  Dan-Mir-2-P3-v2  Dan-Mir-2-P4a  Dan-Mir-2-P4b1  Dan-Mir-2-P4b2  Dan-Mir-2-P5  Dan-Mir-2-P6a  Dan-Mir-2-P6b  Dan-Mir-2-P6c  Dan-Mir-2-P8  Dan-Mir-2-P9 
Orthologues Aae-Mir-2-P7  Bge-Mir-2-P7  Dme-Mir-2-P7  Dmo-Mir-2-P7  Hme-Mir-2-P7  Isc-Mir-2-o7  Tca-Mir-2-P7 
Node of Origin (locus) Neoptera
Node of Origin (family) Protostomia
Genome context
(Dana_caf1)
scaffold_13340: 5675694-5675758 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGUCAUCUCUAAUAUGAGGCGCACUUGCCAAGAACUCUCUCUGUGACUUGUGUCCUUUUUUUCGAAACUCACAUCACAGUCUGAGUUCUUGCUGAGAGCGGGAAUCCUCCAAUCGCAUCAAGG
Get precursor sequence
Structure
        10        20          30        40        50        60   
GCUGUCAUCUCUAAUAUGAGG--|  A   GC         UCU      CU    UCCUUUUU 
                       CGC CUU  CAAGAACUC   CUGUGA  UGUG        \
                       GCG GAG  GUUCUUGAG   GACACU  ACAC        U
GGAACUACGCUAACCUCCUAAGG^  A   UC         UCU      --    UCAAAGCU 
   120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Da
Star sequence

Dan-Mir-2-P7_5p*

MirBase accessionNone
Sequence
0- CAAGAACUCUCUCUGUGACUUGUG -24
Get sequence
Mature sequence

Dan-Mir-2-P7_3p

MirBase accessionMIMAT0008472
Sequence
43- CAUCACAGUCUGAGUUCUUGCU -65
Get sequence