MirGeneDB ID | Ofu-Mir-279-o56 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Ofu-Mir-279-o53 Ofu-Mir-279-o54 Ofu-Mir-279-o55 Ofu-Mir-279-o57 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Agr-Mir-279 Bpl-Mir-279 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gsa-Mir-279 Gsp-Mir-279 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000001.1: 23396616-23396670 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-279-o56) |
Mir-36
CAIIXF020000001.1: 23393833-23393889 [-]
Mir-279-o56 CAIIXF020000001.1: 23396616-23396670 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AUUAGUAUUUUAUUUUUGUUGAUUUCCGAGAUGAUUGUGGGUCAAGUCCAUGUUUCAUGUUUCAUGACUAGAUCCACACUCAUCCUGGCGAUUUUCAUAGCAUCGCUGAUAGCAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AUUAGUAUUUUAUUUUU--|UU U A U A C UUUC G GAUU CCG GAUGA UGUGGGUC AGUC AUG A C UUAG GGU CUACU ACACCUAG UCAG UAC U GACGAUAGUCGCUACGAUA^UU C C C A - UUUG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of annelids thus these multiple paralogues are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ofu-Mir-279-o56_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AUGAUUGUGGGUCAAGUCCAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ofu-Mir-279-o56_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
34- UGACUAGAUCCACACUCAUCC -55
Get sequence
|