| MirGeneDB ID | Efe-Mir-279-o37 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Common brandling worm (Eisenia fetida) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Efe-Mir-279-o38 Efe-Mir-279-o39 Efe-Mir-279-o40 Efe-Mir-279-o41 Efe-Mir-279-o42 Efe-Mir-279-o43 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-279 Bpl-Mir-279 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gsa-Mir-279 Gsp-Mir-279 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | E. fetida | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Efe_combined) |
Efet.01.179746: 5176-5236 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUGAUGACAGAUGCUUAGGUUACUUCGUUCGACGUGUGUGAAUCUCGUACGUGUCGUCGUUUGCUAUACAUGACUAGAUACACACUCGUCUACGGAGGUAACGAUUAUCCCGACAACUGGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUGAUGACAGAUGCUUAG- -| UC U A C A UCGUCGU GUUACUU CGU GACG GUGUG AUCU GU CGUG \ CAAUGGA GCA CUGC CACAC UAGA CA GUAC U CGGUCAACAGCCCUAUUAG G^ U- U A U - AUAUCGU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of annelids thus these multiple paralogues are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Efe-Mir-279-o37_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GACGUGUGUGAAUCUCGUACGUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Efe-Mir-279-o37_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UGACUAGAUACACACUCGUCU -61
Get sequence
|
