MirGeneDB

MirGeneDB ID

Dan-Mir-306

Family name MIR-306 (all species)
Seed CAGGUAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-306
Paralogues
Orthologues Aae-Mir-306  Bge-Mir-306  Dme-Mir-306  Dmo-Mir-306  Hme-Mir-306 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dana_caf1)
scaffold_12916: 15864875-15864933 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-306)
Mir-9-P8 scaffold_12916: 15864555-15864614 [-] Ensembl
Mir-9-P10-v1 scaffold_12916: 15864734-15864795 [-] Ensembl
Mir-9-P10-v2 scaffold_12916: 15864734-15864795 [-] Ensembl
Mir-306 scaffold_12916: 15864875-15864933 [-] Ensembl
Mir-9-P9 scaffold_12916: 15865484-15865553 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGAAAGUGCCAGAAGUCCACUUGGUAGCUCAGGUACUUAGUGACUCUCAAUGCAUUUGACAUUUUGGGAGCCACUUUGUGCCUGGGCCAUCAGUGCGACUAUAUCUUCUAUUAAAAA
Get precursor sequence
Structure
        10           20        30        40        50         
UGUGAAAGUGCCAGAAG--  -|   U   A          UU    A       UGCAUU 
                   UC CACU GGU GCUCAGGUAC  AGUG CUCUCAA      \
                   AG GUGA CUA CGGGUCCGUG  UCAC GAGGGUU      U
AAAAAUUAUCUUCUAUAUC  C^   -   C          UU    C       UUACAG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-306_5p

MirBase accessionMIMAT0008450
Sequence
0- UCAGGUACUUAGUGACUCUCAA -22
Get sequence
Star sequence

Dan-Mir-306_3p*

MirBase accessionNone
Sequence
37- GGGAGCCACUUUGUGCCUGGGC -59
Get sequence