MirGeneDB

MirGeneDB ID

Bge-Mir-306

Family name MIR-306 (all species)
Seed CAGGUAC
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues
Orthologues Aae-Mir-306  Dan-Mir-306  Dme-Mir-306  Dmo-Mir-306  Hme-Mir-306 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Bger_2.0)
KZ614731.1: 668749-668804 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUUCAGCAGUAGCAUGUGCUGUUUCCUCUGUCAGGUACUGAGUGACUCUGAGUAAUUUAAUUCUCAGAGGCACUUGGUUUCUGGCCGAGUGAACAGUAUGAACAGCGUAGUUAGCA
Get precursor sequence
Structure
        10          20        30        40        50       
AUUCAGCAGUAGCAUGU--|     UC   U      U  UG    A       UAAU 
                   GCUGUU  CUC GUCAGG AC  AGUG CUCUGAG    U
                   UGACAA  GAG CGGUCU UG  UCAC GAGACUC    U
ACGAUUGAUGCGACAAGUA^     GU   C      U  GU    G       UUAA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-306_5p

MirBase accessionNone
Sequence
0- UCAGGUACUGAGUGACUCUGAG -22
Get sequence
Star sequence

Bge-Mir-306_3p*

MirBase accessionNone
Sequence
34- CAGAGGCACUUGGUUUCUGGCC -56
Get sequence