MirGeneDB

MirGeneDB ID

Dmo-Mir-306

Family name MIR-306 (all species)
Seed CAGGUAC
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-306
Paralogues
Orthologues Aae-Mir-306  Bge-Mir-306  Dan-Mir-306  Dme-Mir-306  Hme-Mir-306 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dmoj_caf1)
scaffold_6500: 7201959-7202025 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-306)
Mir-9-P9 scaffold_6500: 7201357-7201423 [+] Ensembl
Mir-306 scaffold_6500: 7201959-7202025 [+] Ensembl
Mir-9-P10-v1 scaffold_6500: 7202147-7202208 [+] Ensembl
Mir-9-P10-v2 scaffold_6500: 7202147-7202208 [+] Ensembl
Mir-9-P8 scaffold_6500: 7202321-7202381 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGAUUCAUGAUGUCCAGCACACGCUGCAGCUCAGGUACUUAGUGACUCUCAAUCACAUAUUGCUUUGCAUACUUUGAGGGUCGCUCUGUGCCUGUGCCGCCCGUGUUGCACACAGCCACACAAUUGU
Get precursor sequence
Structure
        10           20        30        40        50        60   
CGAUUCAUGAUGUCCAGC---|    CU  A  U       UU            UCACAUAUUG 
                     ACACG  GC GC CAGGUAC  AGUGACUCUCAA          \
                     UGUGC  CG CG GUCCGUG  UCGCUGGGAGUU          C
UGUUAACACACCGACACACGU^    C-  C  U       UC            UCAUACGUUU 
     120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-306_5p

MirBase accessionMIMAT0008648
Sequence
0- UCAGGUACUUAGUGACUCUCAA -22
Get sequence
Star sequence

Dmo-Mir-306_3p*

MirBase accessionMIMAT0008649
Sequence
45- GAGGGUCGCUCUGUGCCUGUGC -67
Get sequence