MirGeneDB

MirGeneDB ID

Aae-Mir-306

Family name MIR-306 (all species)
Seed CAGGUAC
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-306
Paralogues
Orthologues Bge-Mir-306  Dan-Mir-306  Dme-Mir-306  Dmo-Mir-306  Hme-Mir-306 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Aaeg_L3)
supercont1.785: 213078-213173 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-306)
Mir-306 supercont1.785: 213078-213173 [+] Ensembl
Mir-9-P10-v1 supercont1.785: 213277-213338 [+] Ensembl
Mir-9-P10-v2 supercont1.785: 213278-213337 [+] Ensembl
Mir-9-P8 supercont1.785: 213584-213649 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCAACAGAACAUUCGCAAUUUCACCGGUUCAGGUACUGAGUGACUCUCAGAUGUGCAUUUCUCAAGCAAUCUCGUCCUCAGGACCUGAGGUUGAAAAACCCUGAGAGCACCUCGGUAUCUAAGCCAGUGUUGCGAAAAUGCCAACAUCAGAGUG
Get precursor sequence
Structure
        10        20          30        40         50        60        70       
ACCCAACAGAACAUUCGCAAUUU--   C    C         -|  A       AUGUGCAUUUCUCAAGCAAUCUCG 
                         CAC GGUU AGGUACUGA GUG CUCUCAG                        U
                         GUG CCGA UCUAUGGCU CAC GAGAGUC                        C
GUGAGACUACAACCGUAAAAGCGUU   A    A         C^  -       CCAAAAAGUUGGAGUCCAGGACUC 
    150       140       130       120       110        100        90        80
Deep sequencing
Go to detailed chart
CommentThere are Dicer sites -1 and -2 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Mir-306_5p

MirBase accessionMIMAT0014229
Sequence
0- UCAGGUACUGAGUGACUCUCAG -22
Get sequence
Star sequence

Aae-Mir-306_3p*

MirBase accessionMIMAT0014230
Sequence
74- GAGAGCACCUCGGUAUCUAAGC -96
Get sequence