MirGeneDB

MirGeneDB ID

Dme-Mir-306

Family name MIR-306 (all species)
Seed CAGGUAC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-306
Paralogues
Orthologues Aae-Mir-306  Bge-Mir-306  Dan-Mir-306  Dmo-Mir-306  Hme-Mir-306 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(dm6)
chr2L: 16698418-16698476 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-306)
Mir-9-P9 chr2L: 16697936-16698005 [+] UCSC Ensembl
Mir-306 chr2L: 16698418-16698476 [+] UCSC Ensembl
Mir-9-P10-v1 chr2L: 16698572-16698634 [+] UCSC Ensembl
Mir-9-P10-v2 chr2L: 16698572-16698634 [+] UCSC Ensembl
Mir-9-P8 chr2L: 16698758-16698820 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGAAUAGUUUAAAAGUCCACUCGAUGGCUCAGGUACUUAGUGACUCUCAAUGCUUUUGACAUUUUGGGGGUCACUCUGUGCCUGUGCUGCCAGUGGGACAUAAUCUACAAAUAAAGU
Get precursor sequence
Structure
        10           20        30        40        50         
AGUGAAUAGUUUAAAAG---|     CGA    U       UU            UGCUUU 
                    UCCACU   UGGC CAGGUAC  AGUGACUCUCAA      \
                    GGGUGA   GUCG GUCCGUG  UCACUGGGGGUU      U
UGAAAUAAACAUCUAAUACA^     CC-    U       UC            UUACAG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-306_5p

MirBase accessionMIMAT0000393
Sequence
0- UCAGGUACUUAGUGACUCUCAA -22
Get sequence
Validated targets microrna.org: MIMAT0000393
TargetScanFly: dme-miR-306
Star sequence

Dme-Mir-306_3p*

MirBase accessionMIMAT0000394
Sequence
37- GGGGGUCACUCUGUGCCUGUGC -59
Get sequence
Validated targets microrna.org: MIMAT0000394